PCR FLUORESCENTE ASSOCIADA À ELETROFORESE CAPILAR COMO FERRAMENTA DE DIAGNÓSTICO DE BACTÉRIAS NO SEMEN

  • Francisca E. Ferreira Dias Universidade Federal do Tocantins
  • Cáris Marone Nunes Profs. Adjunto - Faculdade de Odontologia /Curso de Medicina Veterinária, UNESP Campus-Araçatuba
  • Tânia Vasconcelos Cavalcante Profs. Adjunto - Escola de Medicina Veterinária e Zootecnia - UFT
  • Andréa A. Pires de Castro Doutoranda da UFT- Pesquisadora da Fundação de Medicina Tropical do Tocantins
  • Jorge Luis Ferreira Profs. Adjunto - Escola de Medicina Veterinária e Zootecnia - UFT
  • José Fernando Garcia Profs. Adjunto - Faculdade de Odontologia /Curso de Medicina Veterinária, UNESP Campus-Araçatuba
Palavras-chave: sêmen bovino, Brucella abortus, PCR fluorescente, Eletroforese capilar, diagnóstico.

Resumo

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 100 a 107 bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF–5’gcgctcaggctgccgacgcaa3’ (cromóforo FAM) e BR–5’accagccattgcggtcggta3’ para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 103 bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 105 bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.

ALAVRAS-CHAVE: Brucella abortus; diagnóstico; eletroforese capilar; PCR fluorescente; sêmen bovino.

 

Downloads

Não há dados estatísticos.

Biografia do Autor

Francisca E. Ferreira Dias, Universidade Federal do Tocantins

Possui graduação em Medicina Veterinária pela Universidade Estadual do Ceará (1997), graduação em Bacharel em Economia Doméstica pela Universidade Federal do Ceará (1990), Mestrado em Ciências Veterinárias pela Universidade Estadual do Ceará (2000) e Doutorado em Medicina Veterinária pela Universidade Estadual Paulista Júlio de Mesquita Filho, Campus de Jaboticabal (2005). Atualmente é Professora Adjunta I da Universidade Federal do Tocantins, no Cursos de Medicina Veterinária e Zootecnia. Tem experiência na área de Medicina Veterinária, com ênfase Reprodução Animal.

Publicado
29-09-2013
Como Citar
Ferreira Dias, F. E., Nunes, C. M., Cavalcante, T. V., Castro, A. A. P. de, Ferreira, J. L., & Garcia, J. F. (2013). PCR FLUORESCENTE ASSOCIADA À ELETROFORESE CAPILAR COMO FERRAMENTA DE DIAGNÓSTICO DE BACTÉRIAS NO SEMEN. Ciência Animal Brasileira, 14(3), 366-372. Recuperado de https://www.revistas.ufg.br/vet/article/view/7638
Seção
Medicina Veterinária